Workflow

Sample submission

Please note that it does take time to appear, please be patient and wait for the text to appear as the processes are running on the server but not output until it is completed.

Details of Submission and Design Process
========================================
Requestor = v1_primer_input.shtml
Positions = GSF21_somatic,1:18534005-18534005
MAMLD1_somatic,X:149389695-149389695
DEPDC5_somatic,22:30535606-30535606
TG_somatic,8:133975137-133975137
CYB561D2_somatic,3:50366115-50366115
XDH_somatic,2:31443353-31443353
LTA_somatic,6:31649423-31649423
CAMK2B_somatic,7:44246838-44246838

p3settings = v1
hg = hg18
Sample_ID = 99999
Project = TEST
Datestamp = 2016022214215328697
Miseq = 150
Writing to /var/www/html/logs

Output saved to /var/www/html/logs
Writing to /var/www/html/requests
Writing 2016022214215328697
Written to  /var/www/html/output/2016022214215328697
 Using v1 settings
-------------------------------------------------
View the output online in another browser window when done:
https://pleione.myseqtools.com/output/TEST/99999
-------------------------------------------------

 

LiftOver from hg18 -> hg19 positions

If hg19 positions are input, this step is skipped.

This is the value of hg = hg18
This is the value of sample = 99999
This is the value of dir = TEST
This is the value of file = 2016022214215328697

Converting hg18->hg19, please double check the data when done. Listing of /var/www/html/output/TEST/99999/positions/2016022214215328697-hg18
GSF21_somatic,1:18534005-18534005
MAMLD1_somatic,X:149389695-149389695
DEPDC5_somatic,22:30535606-30535606
TG_somatic,8:133975137-133975137
CYB561D2_somatic,3:50366115-50366115
XDH_somatic,2:31443353-31443353
LTA_somatic,6:31649423-31649423
CAMK2B_somatic,7:44246838-44246838

Lifting...
/opt/liftOver /var/www/html/output/TEST/99999/positions/2016022214215328697_hg18.tmp /srv/hg18ToHg19.over.chain /var/www/html/output/TEST/99999/positions/2016022214215328697-hg19 /var/www/html/output/TEST/99999/positions/2016022214215328697-unmap.txt
Lifted.
===================================
These are the hg18 positions:
chr1 18534005 18534006 GSF21_somatic 
chrX 149389695 149389696 MAMLD1_somatic 
chr22 30535606 30535607 DEPDC5_somatic 
chr8 133975137 133975138 TG_somatic 
chr3 50366115 50366116 CYB561D2_somatic 
chr2 31443353 31443354 XDH_somatic 
chr6 31649423 31649424 LTA_somatic 
chr7 44246838 44246839 CAMK2B_somatic 
These are the hg19 positions:
chr1	18661418	18661419	GSF21_somatic
chrX	149639037	149639038	MAMLD1_somatic
chr22	32205606	32205607	DEPDC5_somatic
chr8	133905955	133905956	TG_somatic
chr3	50391111	50391112	CYB561D2_somatic
chr2	31589849	31589850	XDH_somatic
chr6	31541444	31541445	LTA_somatic
chr7	44280313	44280314	CAMK2B_somatic
===================================
These are the positions which cannot be mapped:
===================================
There are 8 positions in the list

=============================================

Getting WT position and SNV position is just the complementary

We are implementing v2.0 which would take the positions from external input. It also extracts the primer design space which is the WT sequences 300 bp upstream and downstream of the SNV/SNP position. In v2.0, we want to be able to read the sequence from the input.

=============================================
Rscript /var/www/cgi-bin/v1_GetSeq.R --no-save --no-restore --args TEST/99999/2016022214215328697
[1] "Hello!"
[1] "Genome loaded..."
[1] "Directory"
[1] "TEST"
[1] "Sample_ID"
[1] "99999"
[1] "File"
[1] "2016022214215328697"
[1] "GSF21_somatic_chr1_18661418"
[1] "MAMLD1_somatic_chrX_149639037"
[1] "DEPDC5_somatic_chr22_32205606"
[1] "TG_somatic_chr8_133905955"
[1] "CYB561D2_somatic_chr3_50391111"
[1] "XDH_somatic_chr2_31589849"
[1] "LTA_somatic_chr6_31541444"
[1] "CAMK2B_somatic_chr7_44280313"
                              ID   Chr      Pos1      Pos2 SNV         Cxt
1    GSF21_somatic_chr1_18661418  chr1  18661418  18661418   C TGGTCCCTATG
2  MAMLD1_somatic_chrX_149639037  chrX 149639037 149639037   G ATGCTGCCCTG
3  DEPDC5_somatic_chr22_32205606 chr22  32205606  32205606   G CCTCTGAGAAA
4      TG_somatic_chr8_133905955  chr8 133905955 133905955   G AGGAAGCAAAG
5 CYB561D2_somatic_chr3_50391111  chr3  50391111  50391111   C CCTCACCAGCT
6      XDH_somatic_chr2_31589849  chr2  31589849  31589849   T ACCGATGTATA
7      LTA_somatic_chr6_31541444  chr6  31541444  31541444   G GTACTGTCTTC
8   CAMK2B_somatic_chr7_44280313  chr7  44280313  44280313   A GAGAAATTCCG                                                                                                   Seq
1 TCCCATACTGCATGCAGCGACATACTAAATGCCCATACCTCTTCACCTGTGCCATCCTCACGGCTCCCTGGAAGTGGGCACCATCCCAGGCTCATGGA(truncated)
2 TCCTTCCACCAGTAAGCAGATAGTGTCACCGAGTTCTTCAATGGCACAGTCCAAGAGCCAGGTCCAGGCCATGCTCCCTGTCGCTCTGCCCCCCTTAC(truncated)
3 CAGCACCGTAGTGAAGGGGGAGGCATGCAGCATTTGGGTCAGGTGGGACAAACACAACAGTGGATTGACCAAGAATCTAAAGATCTGGTCTTGAATTT(truncated)
4 TGATCTGTATGTGCATACTGTGTGTATGGTGTGTATAGGTGTGTGTGGTGTGTCTGTGGTGTATATGTGTGTAGTGTGGGGGGGTGGTGTGTATGTGT(truncated)
5 CCTGAGAGTTCGCTGCTGCACTCCCTCTCACGGAAAGGCCGAGCACGCTGCCACTGGGTGCTGCAGCTGCTGGCCCTGCTGTGTGCACTGCTGGGCCT(truncated)
6 CAACATGTACCAAACTCTAGTCTAAATATTAAAACTCATCTAATAATTATGACAACCCACCCAGGCCCCATTTTATAAATGAGAAAACTGAGGCTGAG(truncated)
7 ATGGCTCTTCCTAGGAGACCCCAGCAAGCAGAACTCACTGCTCTGGAGAGCAAACACGGACCGTGCCTTCCTCCAGGATGGTTTCTCCTTGAGCAACA(truncated)
8 CCCCGCATCCCTTCTGCCCACCTCCCGCACAAAACACAATGTTCAGAGCACTCAAAATGACAAGGAGGCCACATAGATGCCCGACAAACGCCTGGACA(truncated)
    Chr      Pos1                             ID
1  chr1  18661418    GSF21_somatic_chr1_18661418
2  chrX 149639037  MAMLD1_somatic_chrX_149639037
3 chr22  32205606  DEPDC5_somatic_chr22_32205606
4  chr8 133905955      TG_somatic_chr8_133905955
5  chr3  50391111 CYB561D2_somatic_chr3_50391111
6  chr2  31589849      XDH_somatic_chr2_31589849
7  chr6  31541444      LTA_somatic_chr6_31541444
8  chr7  44280313   CAMK2B_somatic_chr7_44280313
  Chr      Pos1      Pos2 WT SNV
1   1  18661418  18661418  C   G
2   X 149639037 149639037  G   C
3  22  32205606  32205606  G   C
4   8 133905955 133905955  G   C
5   3  50391111  50391111  C   G
6   2  31589849  31589849  T   A
7   6  31541444  31541444  G   C
8   7  44280313  44280313  A   T
[1] "v1_GetSeq.R complete..."
=================================================

 

Primer Design using Primer3

There are different pre-configured conditions that can be selected on the input page. In this example, we use v1 (see line in the sample submission section, p3settings = v1)

Designing primers...
 (This takes a while please wait):
Name of project: 2016022214215328697
tmp directory is ok
/var/www/html/output/TEST/99999/positions/2016022214215328697-hg19.csv
/var/www/html/output/TEST/99999/primer3/2016022214215328697_p3_design.txt
Generating primer3 input file...
File to output  /var/www/html/temp/2016022214215328697_p3_output
Input file (with full path): /var/www/html/temp/2016022214215328697_primer3_input.txt
Output to this directory /var/www/html/temp

Number of sequences in input file
8
Number of outputs in  /var/www/html/temp/2016022214215328697_p3_output
8
================================
Number of failed sequences where there are no primers
0

Generating in-silico PCR input file
#################################################

Checking amplicons/primers using in-silico PCR

Annotate
positions
primer3
2016022214215328697
File from primer3 output to process: /var/www/html/temp/2016022214215328697_p3_output.txt
Output to this directory /var/www/html/output/TEST/99999/primer3
Processing...
******************PASS!**********************
TG_somatic_chr8_133905955,chr8_133905955,8,133905955,TTTTATTCCCCTAGGTCCTGGC,AAGGCCGAGGTCCTCATTC,169
TG_somatic_chr8_133905955,8,169,TTTTATTCCCCTAGGTCCTGGC,AAGGCCGAGGTCCTCATTC,TTTTATTCCCCTAGGTCCTGGCtcctgtgaggaagcaaagctccgtgtactgcagttcattagggaaacggaagagattgtttcagcttccaacagttctcggttccctctgggggagagtttcctggtggccaagggaatccggctgagGAATGAGGACCTCGGCCTT
===========================
******************PASS!**********************
TG_somatic_chr8_133905955,chr8_133905955,8,133905955,TATGTGTGTGCGTGAGGGC,AGCTGAAACAATCTCTTCCGTT,167
TG_somatic_chr8_133905955,8,167,TATGTGTGTGCGTGAGGGC,AGCTGAAACAATCTCTTCCGTT,TATGTGTGTGCGTGAGGGCacacatgcttcatgggagtcagagggaagtccacgtggtgagtgagtccatctgtgttatttttattcccctaggtcctggctcctgtgaggaagcaaagctccgtgtactgcagttcattagggaAACGGAAGAGATTGTTTCAGCT
===========================
******************PASS!**********************
TG_somatic_chr8_133905955,chr8_133905955,8,133905955,GTGAGTGAGTCCATCTGTGTTA,GGATTCCCTTGGCCACCA,166
TG_somatic_chr8_133905955,8,166,GTGAGTGAGTCCATCTGTGTTA,GGATTCCCTTGGCCACCA,GTGAGTGAGTCCATCTGTGTTAtttttattcccctaggtcctggctcctgtgaggaagcaaagctccgtgtactgcagttcattagggaaacggaagagattgtttcagcttccaacagttctcggttccctctgggggagagtttccTGGTGGCCAAGGGAATCC
===========================
******************PASS!**********************
TG_somatic_chr8_133905955,chr8_133905955,8,133905955,ACGTGGTGAGTGAGTCCA,TCAGCCGGATTCCCTTGG,177
TG_somatic_chr8_133905955,8,177,ACGTGGTGAGTGAGTCCA,TCAGCCGGATTCCCTTGG,ACGTGGTGAGTGAGTCCAtctgtgttatttttattcccctaggtcctggctcctgtgaggaagcaaagctccgtgtactgcagttcattagggaaacggaagagattgtttcagcttccaacagttctcggttccctctgggggagagtttcctggtggCCAAGGGAATCCGGCTGA
===========================
.
******************PASS!**********************
MAMLD1_somatic_chrX_149639037,chrX_149639037,X,149639037,AATGCCTTACTGTCAAGCATGA,GAGGGGTTTTGATGGTAGAGGA,166
MAMLD1_somatic_chrX_149639037,X,166,AATGCCTTACTGTCAAGCATGA,GAGGGGTTTTGATGGTAGAGGA,AATGCCTTACTGTCAAGCATGAcgtccagcagcaatgctgccctggggcccgccatgccctatgctcctgagaagctccccagccctgctctcactcaacagccgcagttcggccctcagagctccattcttgccaacctcatgTCCTCTACCATCAAAACCCCTC
===========================
******************PASS!**********************
MAMLD1_somatic_chrX_149639037,chrX_149639037,X,149639037,GCATGTCGTCCAATACCTTGTC,AAGAATGGAGCTCTGAGGGC,179
MAMLD1_somatic_chrX_149639037,X,179,GCATGTCGTCCAATACCTTGTC,AAGAATGGAGCTCTGAGGGC,GCATGTCGTCCAATACCTTGTCgggtagcactctccgaggctctcccaatgccttactgtcaagcatgacgtccagcagcaatgctgccctggggcccgccatgccctatgctcctgagaagctccccagccctgctctcactcaacagccgcagttcgGCCCTCAGAGCTCCATTCTT
===========================
******************PASS!**********************
MAMLD1_somatic_chrX_149639037,chrX_149639037,X,149639037,CTTGTCGGGTAGCACTCTCC,CATGAGGTTGGCAAGAATGGAG,175
MAMLD1_somatic_chrX_149639037,X,175,CTTGTCGGGTAGCACTCTCC,CATGAGGTTGGCAAGAATGGAG,CTTGTCGGGTAGCACTCTCCgaggctctcccaatgccttactgtcaagcatgacgtccagcagcaatgctgccctggggcccgccatgccctatgctcctgagaagctccccagccctgctctcactcaacagccgcagttcggccctcagagCTCCATTCTTGCCAACCTCATG
===========================
******************PASS!**********************
MAMLD1_somatic_chrX_149639037,chrX_149639037,X,149639037,GTCCTGCATGTCGTCCAATAC,GAACTGCGGCTGTTGAGTG,163
MAMLD1_somatic_chrX_149639037,X,163,GTCCTGCATGTCGTCCAATAC,GAACTGCGGCTGTTGAGTG,GTCCTGCATGTCGTCCAATACcttgtcgggtagcactctccgaggctctcccaatgccttactgtcaagcatgacgtccagcagcaatgctgccctggggcccgccatgccctatgctcctgagaagctccccagccctgctctCACTCAACAGCCGCAGTTC
===========================
.
******************PASS!**********************
GSF21_somatic_chr1_18661418,chr1_18661418,1,18661418,ACGATGAAGGGCCCTCAC,CTCACCCATGACGTTGAGGAAG,163
GSF21_somatic_chr1_18661418,1,163,ACGATGAAGGGCCCTCAC,CTCACCCATGACGTTGAGGAAG,ACGATGAAGGGCCCTCACcctgtcttctgcctcccccaggctgcccgaggtccggatctcagacaatggtccctatgagtgccatgtgggcatctacgaccgcgccaccagggagaaggtggtcctggcatcaggcaacatCTTCCTCAACGTCATGGGTGAG
===========================
******************PASS!**********************
GSF21_somatic_chr1_18661418,chr1_18661418,1,18661418,GATGAGTTTCCTTGAACGCTG,GGACCACCTTCTCCCTGG,160
GSF21_somatic_chr1_18661418,1,160,GATGAGTTTCCTTGAACGCTG,GGACCACCTTCTCCCTGG,GATGAGTTTCCTTGAACGCTGcctcacccagccccacgatgaagggccctcaccctgtcttctgcctcccccaggctgcccgaggtccggatctcagacaatggtccctatgagtgccatgtgggcatctacgaccgcgccaCCAGGGAGAAGGTGGTCC
===========================
******************PASS!**********************
GSF21_somatic_chr1_18661418,chr1_18661418,1,18661418,GCCCTCACCCTGTCTTCTG,CCCTGCACTCACCCATGA,160
GSF21_somatic_chr1_18661418,1,160,GCCCTCACCCTGTCTTCTG,CCCTGCACTCACCCATGA,GCCCTCACCCTGTCTTCTGcctcccccaggctgcccgaggtccggatctcagacaatggtccctatgagtgccatgtgggcatctacgaccgcgccaccagggagaaggtggtcctggcatcaggcaacatcttcctcaacgTCATGGGTGAGTGCAGGG
===========================
******************PASS!**********************
GSF21_somatic_chr1_18661418,chr1_18661418,1,18661418,CAGCCCCACGATGAAGGG,GCACTCACCCATGACGTTG,173
GSF21_somatic_chr1_18661418,1,173,CAGCCCCACGATGAAGGG,GCACTCACCCATGACGTTG,CAGCCCCACGATGAAGGGccctcaccctgtcttctgcctcccccaggctgcccgaggtccggatctcagacaatggtccctatgagtgccatgtgggcatctacgaccgcgccaccagggagaaggtggtcctggcatcaggcaacatcttcctCAACGTCATGGGTGAGTGC
===========================
.
Possible non-specific amplicon - not useful if run in multi mode
Possible non-specific amplicon - not useful if run in multi mode
******************PASS!**********************
LTA_somatic_chr6_31541444,chr6_31541444,6,31541444,TATCCAGGGCTGCAGGAAC,TCCAAGTTCTACAGAGCGAAGG,161
LTA_somatic_chr6_31541444,6,161,TATCCAGGGCTGCAGGAAC,TCCAAGTTCTACAGAGCGAAGG,TATCCAGGGCTGCAGGAACcctggctgcactcgatgtaccacggggctgcgttccagctcacccagggagaccagctatccacccacacagatggcatcccccacctagtcctcagccctagtactgtcttctttggagCCTTCGCTCTGTAGAACTTGGA
===========================
Possible non-specific amplicon - not useful if run in multi mode
******************PASS!**********************
LTA_somatic_chr6_31541444,chr6_31541444,6,31541444,TATCCACCCACACAGATGGC,AAAGGAGAGGTGGTGACGAC,178
LTA_somatic_chr6_31541444,6,178,TATCCACCCACACAGATGGC,AAAGGAGAGGTGGTGACGAC,TATCCACCCACACAGATGGCatcccccacctagtcctcagccctagtactgtcttctttggagccttcgctctgtagaacttggaaaaatccagaaagaaaaaataattgatttcaagaccttctccccattctgcctccattctgaccatttcagggGTCGTCACCACCTCTCCTTT
===========================
Possible non-specific amplicon - not useful if run in multi mode
******************PASS!**********************
LTA_somatic_chr6_31541444,chr6_31541444,6,31541444,CAGCTCACCCAGGGAGAC,GTCAGAATGGAGGCAGAATGG,170
LTA_somatic_chr6_31541444,6,170,CAGCTCACCCAGGGAGAC,GTCAGAATGGAGGCAGAATGG,CAGCTCACCCAGGGAGACcagctatccacccacacagatggcatcccccacctagtcctcagccctagtactgtcttctttggagccttcgctctgtagaacttggaaaaatccagaaagaaaaaataattgatttcaagaccttctccCCATTCTGCCTCCATTCTGAC
===========================
Possible non-specific amplicon - not useful if run in multi mode
******************PASS!**********************
LTA_somatic_chr6_31541444,chr6_31541444,6,31541444,CCCACACAGATGGCATCCC,GTGACGACCCCTGAAATGG,160
LTA_somatic_chr6_31541444,6,160,CCCACACAGATGGCATCCC,GTGACGACCCCTGAAATGG,CCCACACAGATGGCATCCCccacctagtcctcagccctagtactgtcttctttggagccttcgctctgtagaacttggaaaaatccagaaagaaaaaataattgatttcaagaccttctccccattctgcctccattctgaCCATTTCAGGGGTCGTCAC
===========================
.
******************PASS!**********************
XDH_somatic_chr2_31589849,chr2_31589849,2,31589849,CTACCTGGGTCTTCATGGTGTT,GCCCCTTCTGCAGCATTG,180
XDH_somatic_chr2_31589849,2,180,CTACCTGGGTCTTCATGGTGTT,GCCCCTTCTGCAGCATTG,CTACCTGGGTCTTCATGGTGTTctgtgtagacacaaagagctccatctcccctgcctcgccttttggaacagcaatggtgcagtgagtctccaggtagaagtgctcttggccaccgatgtatatctcccctggggaagcagtgagatccctcacagtgagccCAATGCTGCAGAAGGGGC
===========================
******************PASS!**********************
XDH_somatic_chr2_31589849,chr2_31589849,2,31589849,CCCTTGAGCTGACCCAAAAG,GGATCTCACTGCTTCCCCA,173
XDH_somatic_chr2_31589849,2,173,CCCTTGAGCTGACCCAAAAG,GGATCTCACTGCTTCCCCA,CCCTTGAGCTGACCCAAAAGgcatctacctgggtcttcatggtgttctgtgtagacacaaagagctccatctcccctgcctcgccttttggaacagcaatggtgcagtgagtctccaggtagaagtgctcttggccaccgatgtatatctccccTGGGGAAGCAGTGAGATCC
===========================
******************PASS!**********************
XDH_somatic_chr2_31589849,chr2_31589849,2,31589849,CCCCTGCCTCGCCTTTTG,TCCTGCCCAGACCACTTG,180
XDH_somatic_chr2_31589849,2,180,CCCCTGCCTCGCCTTTTG,TCCTGCCCAGACCACTTG,CCCCTGCCTCGCCTTTTGgaacagcaatggtgcagtgagtctccaggtagaagtgctcttggccaccgatgtatatctcccctggggaagcagtgagatccctcacagtgagcccaatgctgcagaaggggccagcttgcctaaggagagagtatactctgcCAAGTGGTCTGGGCAGGA
===========================
******************PASS!**********************
XDH_somatic_chr2_31589849,chr2_31589849,2,31589849,GGCATCTACCTGGGTCTTCAT,AGCTGGCCCCTTCTGCAG,190
XDH_somatic_chr2_31589849,2,190,GGCATCTACCTGGGTCTTCAT,AGCTGGCCCCTTCTGCAG,GGCATCTACCTGGGTCTTCATggtgttctgtgtagacacaaagagctccatctcccctgcctcgccttttggaacagcaatggtgcagtgagtctccaggtagaagtgctcttggccaccgatgtatatctcccctggggaagcagtgagatccctcacagtgagcccaatgCTGCAGAAGGGGCCAGCT
===========================
.
.
******************PASS!**********************
CAMK2B_somatic_chr7_44280313,chr7_44280313,7,44280313,GAGGAGGAGTGGAGAGGCT,TTTATCTGTGTCTCTCCCCAGG,161
CAMK2B_somatic_chr7_44280313,7,161,GAGGAGGAGTGGAGAGGCT,TTTATCTGTGTCTCTCCCCAGG,GAGGAGGAGTGGAGAGGCTggtgaggaaggaggcgctctcctgcgtgggccagcagggagggggcagcgcctgtctccctggagaagaaaggctcacctgagaaattccgtgtggccagcatggtggtgaggatggctcCCTGGGGAGAGACACAGATAAA
===========================
******************PASS!**********************
CAMK2B_somatic_chr7_44280313,chr7_44280313,7,44280313,GTGGAGAGGCTGGTGAGG,AGGGAACACTGATGGGATAGC,180
CAMK2B_somatic_chr7_44280313,7,180,GTGGAGAGGCTGGTGAGG,AGGGAACACTGATGGGATAGC,GTGGAGAGGCTGGTGAGGaaggaggcgctctcctgcgtgggccagcagggagggggcagcgcctgtctccctggagaagaaaggctcacctgagaaattccgtgtggccagcatggtggtgaggatggctccctggggagagacacagataaaaccgggGCTATCCCATCAGTGTTCCCT
===========================
.
******************PASS!**********************
CYB561D2_somatic_chr3_50391111,chr3_50391111,3,50391111,CTGGTACCTGGCTGTATTATGC,GAGAGAGTTCAACAGGTCCCTA,174
CYB561D2_somatic_chr3_50391111,3,174,CTGGTACCTGGCTGTATTATGC,GAGAGAGTTCAACAGGTCCCTA,CTGGTACCTGGCTGTATTATGCcctgtcctcaccagcttggtcattatgaaccaggtgagcaatgcctacctataccgcaagaggatccaaccatgagctcttcccagcctaggggaagcctggatttgcccctccatgtaggagctgggccTAGGGACCTGTTGAACTCTCTC
===========================
******************PASS!**********************
CYB561D2_somatic_chr3_50391111,chr3_50391111,3,50391111,CTACTTCTGGGCTGGTGGG,TCTTGCGGTATAGGTAGGCATT,177
CYB561D2_somatic_chr3_50391111,3,177,CTACTTCTGGGCTGGTGGG,TCTTGCGGTATAGGTAGGCATT,CTACTTCTGGGCTGGTGGGctacctgctgggtagtgccagcctcttgctgggcatgtgctcactctggttcactgcctctgtcactggtgcagcctggtacctggctgtattatgccctgtcctcaccagcttggtcattatgaaccaggtgagcAATGCCTACCTATACCGCAAGA
===========================
******************PASS!**********************
CYB561D2_somatic_chr3_50391111,chr3_50391111,3,50391111,CTCAAGCTATACCATGCTACTTCT,GTAGGCATTGCTCACCTGG,180
CYB561D2_somatic_chr3_50391111,3,180,CTCAAGCTATACCATGCTACTTCT,GTAGGCATTGCTCACCTGG,CTCAAGCTATACCATGCTACTTCTgggctggtgggctacctgctgggtagtgccagcctcttgctgggcatgtgctcactctggttcactgcctctgtcactggtgcagcctggtacctggctgtattatgccctgtcctcaccagcttggtcattatgaaCCAGGTGAGCAATGCCTAC
===========================
******************PASS!**********************
CYB561D2_somatic_chr3_50391111,chr3_50391111,3,50391111,CTCTGGTTCACTGCCTCTGT,GCAAATCCAGGCTTCCCC,162
CYB561D2_somatic_chr3_50391111,3,162,CTCTGGTTCACTGCCTCTGT,GCAAATCCAGGCTTCCCC,CTCTGGTTCACTGCCTCTGTcactggtgcagcctggtacctggctgtattatgccctgtcctcaccagcttggtcattatgaaccaggtgagcaatgcctacctataccgcaagaggatccaaccatgagctcttcccagcctaGGGGAAGCCTGGATTTGC
===========================

Generating standard output files

The output includes

  • list of primers
2016022214215328697_primerlist.txt
  • primer3 design input (for reference and QC only)
2016022214215328697_p3_design.txt
  • in-silico-PCR input file (for reference and QC only)
2016022214215328697_isPCR-input
  • AmpliconManifest file for Ilumina MiSeq (need to check)
2016022214215328697_AmpliconManifest
Primer List compiled ...
AmpliconManifest compiled ...
####################################################
Generating order file...
Files transferred to html path for viewing...
=============================================================
Primer Design Completed. Please check this address for your results.

https://pleione.myseqtools.com/output/TEST/99999/primer3
and download all the files beginning with code 2016022214215328697
=============================================================

%d bloggers like this: